ID: 1155081619_1155081623

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1155081619 1155081623
Species Human (GRCh38) Human (GRCh38)
Location 18:22415947-22415969 18:22415974-22415996
Sequence CCATCCATTTTATCCAAAGAAGG TTAAAACTTCTGAGTTCTGCTGG
Strand - +
Off-target summary {0: 5, 1: 5, 2: 1, 3: 23, 4: 194} {0: 7, 1: 5, 2: 0, 3: 20, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!