ID: 1155163258_1155163262

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1155163258 1155163262
Species Human (GRCh38) Human (GRCh38)
Location 18:23212509-23212531 18:23212548-23212570
Sequence CCAAAAGCCGAAAGTGGCTTTTG GCAGCCCTGCCCTCCCATGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!