ID: 1155192206_1155192211

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1155192206 1155192211
Species Human (GRCh38) Human (GRCh38)
Location 18:23439990-23440012 18:23440029-23440051
Sequence CCTTCCTCCGTATTCACATATCA AATTTGTTGCCTCACGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!