ID: 1155201162_1155201165

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1155201162 1155201165
Species Human (GRCh38) Human (GRCh38)
Location 18:23519077-23519099 18:23519094-23519116
Sequence CCTGTAAAAAGATGCACATATTG ATATTGAAGTTAAATAGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 222} {0: 1, 1: 0, 2: 0, 3: 25, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!