ID: 1155203968_1155203970

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1155203968 1155203970
Species Human (GRCh38) Human (GRCh38)
Location 18:23541433-23541455 18:23541457-23541479
Sequence CCTGTCGGGGAGAGAAGGGCTCT CGTCACTTCTGTTTACAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 96} {0: 1, 1: 0, 2: 2, 3: 24, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!