ID: 1155206692_1155206701

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1155206692 1155206701
Species Human (GRCh38) Human (GRCh38)
Location 18:23564441-23564463 18:23564492-23564514
Sequence CCTCAGATAACCATGTGGCTGGG TAATTATTTTTTGTAGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 782} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!