ID: 1155218293_1155218314

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1155218293 1155218314
Species Human (GRCh38) Human (GRCh38)
Location 18:23662535-23662557 18:23662579-23662601
Sequence CCAGCCCCGCCGCTTCCTCCCGG GAGAGGAAGGAGGAGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 86, 4: 787} {0: 1, 1: 0, 2: 20, 3: 275, 4: 2157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!