ID: 1155236596_1155236601

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1155236596 1155236601
Species Human (GRCh38) Human (GRCh38)
Location 18:23826053-23826075 18:23826069-23826091
Sequence CCCTCTTCCCTCTGCAGATATGT GATATGTGCTGCTGTCAGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!