|
Left Crispr |
Right Crispr |
| Crispr ID |
1155245453 |
1155245461 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
18:23904433-23904455
|
18:23904486-23904508
|
| Sequence |
CCATTTCTTAAAAAAAAAAAAGA |
TTTGGGGGGATGTCAGCTGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 224, 2: 3327, 3: 32328, 4: 145494} |
{0: 1, 1: 0, 2: 0, 3: 17, 4: 160} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|