ID: 1155266893_1155266899

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1155266893 1155266899
Species Human (GRCh38) Human (GRCh38)
Location 18:24103049-24103071 18:24103080-24103102
Sequence CCGTGATCACGCCACTGCATTCC CAACAGAGTGAGACCGTGTCTGG
Strand - +
Off-target summary {0: 58, 1: 1686, 2: 25750, 3: 93283, 4: 143998} {0: 1, 1: 23, 2: 105, 3: 270, 4: 669}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!