ID: 1155337855_1155337860

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1155337855 1155337860
Species Human (GRCh38) Human (GRCh38)
Location 18:24783713-24783735 18:24783747-24783769
Sequence CCTTCCACATGGCAGGCTGCCTC CTCATAGGTCCAGTTTTGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 6, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!