ID: 1155384995_1155384999

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1155384995 1155384999
Species Human (GRCh38) Human (GRCh38)
Location 18:25267405-25267427 18:25267431-25267453
Sequence CCAGCACAGCATTCGAGCTCTGA GGGTCAGACTGCCTCCTCAAGGG
Strand - +
Off-target summary {0: 15, 1: 93, 2: 244, 3: 596, 4: 1034} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!