|
Left Crispr |
Right Crispr |
Crispr ID |
1155467219 |
1155467227 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
18:26150419-26150441
|
18:26150451-26150473
|
Sequence |
CCTTAAACTCCTGGGCTCAAGCA |
CCGCAGCCTCCCAAGTAGCTAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 236, 1: 95224, 2: 206357, 3: 248299, 4: 264484} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|