ID: 1155467220_1155467227

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1155467220 1155467227
Species Human (GRCh38) Human (GRCh38)
Location 18:26150428-26150450 18:26150451-26150473
Sequence CCTGGGCTCAAGCAATCCCCCCG CCGCAGCCTCCCAAGTAGCTAGG
Strand - +
Off-target summary No data {0: 236, 1: 95224, 2: 206357, 3: 248299, 4: 264484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!