ID: 1155488573_1155488581

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1155488573 1155488581
Species Human (GRCh38) Human (GRCh38)
Location 18:26373788-26373810 18:26373811-26373833
Sequence CCTCCCTCCCTCTGTTCACCCAG TGTTACTGAGTACAATGGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!