ID: 1155507829_1155507841

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1155507829 1155507841
Species Human (GRCh38) Human (GRCh38)
Location 18:26549170-26549192 18:26549199-26549221
Sequence CCCGCGGCCAGGGCGCAGCGGGC TGGGAGCGGGATGGGGCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 288} {0: 1, 1: 0, 2: 10, 3: 101, 4: 1111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!