ID: 1155521366_1155521371 |
View in Genome Browser |
Spacer: 23 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1155521366 | 1155521371 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 18:26672206-26672228 | 18:26672252-26672274 |
| Sequence | CCACACACTTTCTGTTGAACAGT | GGCTTTGGTTTTGTGCTCAGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 0, 3: 17, 4: 218} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||