ID: 1155523933_1155523941

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1155523933 1155523941
Species Human (GRCh38) Human (GRCh38)
Location 18:26697534-26697556 18:26697561-26697583
Sequence CCCACTTTCAATTACATGCAAAT GGGTGGGTCAATGCAATTTGAGG
Strand - +
Off-target summary {0: 26, 1: 115, 2: 189, 3: 287, 4: 465} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!