ID: 1155523934_1155523941

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1155523934 1155523941
Species Human (GRCh38) Human (GRCh38)
Location 18:26697535-26697557 18:26697561-26697583
Sequence CCACTTTCAATTACATGCAAATT GGGTGGGTCAATGCAATTTGAGG
Strand - +
Off-target summary {0: 22, 1: 98, 2: 205, 3: 271, 4: 495} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!