ID: 1155702096_1155702100

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1155702096 1155702100
Species Human (GRCh38) Human (GRCh38)
Location 18:28758900-28758922 18:28758921-28758943
Sequence CCCAGAGGAGAAAAAGTTATCTC TCTTATATGAAGGAGTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 269} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!