ID: 1155808869_1155808877

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1155808869 1155808877
Species Human (GRCh38) Human (GRCh38)
Location 18:30206699-30206721 18:30206742-30206764
Sequence CCCTCTCTCCTGTCCATATCAGA TCTCCACTGACATTAGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 39, 3: 137, 4: 490} {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!