ID: 1155819619_1155819623

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1155819619 1155819623
Species Human (GRCh38) Human (GRCh38)
Location 18:30358859-30358881 18:30358908-30358930
Sequence CCATGTGGCTATTCAGGAAGACA TGAATTCAGGAATATAAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 35, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!