ID: 1155888972_1155888974

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1155888972 1155888974
Species Human (GRCh38) Human (GRCh38)
Location 18:31242935-31242957 18:31242969-31242991
Sequence CCACCTGAAACTAACTAGCACAC CTTGAGCTGCACAGAGACCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!