ID: 1155910338_1155910349

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1155910338 1155910349
Species Human (GRCh38) Human (GRCh38)
Location 18:31498155-31498177 18:31498188-31498210
Sequence CCGGGGGGAGGCCGGGGCCAGGG TGCGCGCTCGGGGCAGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 151, 4: 1086} {0: 1, 1: 1, 2: 2, 3: 12, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!