ID: 1155918373_1155918380

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1155918373 1155918380
Species Human (GRCh38) Human (GRCh38)
Location 18:31578118-31578140 18:31578150-31578172
Sequence CCCAGTCTCAGGTATGTCTTTAT GAAAATGAACAAATGCAGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!