ID: 1155938026_1155938029

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1155938026 1155938029
Species Human (GRCh38) Human (GRCh38)
Location 18:31774594-31774616 18:31774614-31774636
Sequence CCACAGTGGCTGAAGGTCTTCGT CGTGACATGGAACTAGAGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!