ID: 1156030563_1156030567

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1156030563 1156030567
Species Human (GRCh38) Human (GRCh38)
Location 18:32707727-32707749 18:32707749-32707771
Sequence CCATGTGACTCCACAGGAGCAGC CACTCTTGGAAGCTTGAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 39, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!