ID: 1156047179_1156047184

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1156047179 1156047184
Species Human (GRCh38) Human (GRCh38)
Location 18:32889877-32889899 18:32889915-32889937
Sequence CCAAACTGGAAGGGGCACAGGAA GTTAATGCACAGCTTCCTATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!