ID: 1156088843_1156088857

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1156088843 1156088857
Species Human (GRCh38) Human (GRCh38)
Location 18:33440890-33440912 18:33440941-33440963
Sequence CCCAGTGCCTTTCCCTTTCTCTT CCCTCTTTACCGGAGAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 108, 4: 984} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!