ID: 1156160296_1156160304

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1156160296 1156160304
Species Human (GRCh38) Human (GRCh38)
Location 18:34350945-34350967 18:34350963-34350985
Sequence CCTGCTGCCTCTGCCCCTCCTGA CCTGACTTTGGGCTCCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 104, 4: 982} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!