|
Left Crispr |
Right Crispr |
| Crispr ID |
1156188367 |
1156188372 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
18:34689910-34689932
|
18:34689957-34689979
|
| Sequence |
CCAGTCTGAACTCCCAGTGGCTT |
ACCTACTCAAGCCTCAGTAATGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 224, 1: 1946, 2: 1882, 3: 1130, 4: 1039} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|