ID: 1156188367_1156188372

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1156188367 1156188372
Species Human (GRCh38) Human (GRCh38)
Location 18:34689910-34689932 18:34689957-34689979
Sequence CCAGTCTGAACTCCCAGTGGCTT ACCTACTCAAGCCTCAGTAATGG
Strand - +
Off-target summary No data {0: 224, 1: 1946, 2: 1882, 3: 1130, 4: 1039}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!