ID: 1156232181_1156232185

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1156232181 1156232185
Species Human (GRCh38) Human (GRCh38)
Location 18:35164349-35164371 18:35164376-35164398
Sequence CCAGCTCCAGGAATCTGTTTGGA CAAGCCACTTCCTTGTTGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 15, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!