ID: 1156327114_1156327124

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1156327114 1156327124
Species Human (GRCh38) Human (GRCh38)
Location 18:36084971-36084993 18:36084998-36085020
Sequence CCATCTAGAGTGGCCGCTGCTGT TGGGCTACAGAGGGGGGGCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!