ID: 1156419293_1156419309

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1156419293 1156419309
Species Human (GRCh38) Human (GRCh38)
Location 18:36933626-36933648 18:36933668-36933690
Sequence CCAGCCCACAGTTCTGTCCTCCA CAGCTGTTCTAGGGGATCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 342} {0: 1, 1: 0, 2: 0, 3: 13, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!