ID: 1156447104_1156447115

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1156447104 1156447115
Species Human (GRCh38) Human (GRCh38)
Location 18:37245260-37245282 18:37245288-37245310
Sequence CCAATAGGAACCTGCCTCAGGGG ATGGGAGCTCTAGGGGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114} {0: 1, 1: 0, 2: 3, 3: 25, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!