ID: 1156448272_1156448285

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1156448272 1156448285
Species Human (GRCh38) Human (GRCh38)
Location 18:37252799-37252821 18:37252847-37252869
Sequence CCCCAAGTACCTAACACAGTAGC GGAGGAACATGGGCAGGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 104, 4: 1017}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!