ID: 1156455027_1156455030

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1156455027 1156455030
Species Human (GRCh38) Human (GRCh38)
Location 18:37288227-37288249 18:37288243-37288265
Sequence CCTCCACTGCACCTAATGAGGTC TGAGGTCCTCCCTTCCTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!