ID: 1156468033_1156468041

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1156468033 1156468041
Species Human (GRCh38) Human (GRCh38)
Location 18:37360377-37360399 18:37360421-37360443
Sequence CCAGCCTGCTGAGCACAACCTGT CCTTCAAGTGGACCCCTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185} {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!