ID: 1156468033_1156468045

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1156468033 1156468045
Species Human (GRCh38) Human (GRCh38)
Location 18:37360377-37360399 18:37360425-37360447
Sequence CCAGCCTGCTGAGCACAACCTGT CAAGTGGACCCCTGAGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!