ID: 1156499035_1156499049

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1156499035 1156499049
Species Human (GRCh38) Human (GRCh38)
Location 18:37545318-37545340 18:37545365-37545387
Sequence CCTTCCTCCTGCTGCCTAGTAGC GGTGGGCTGGGGCCAGGCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 89, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!