ID: 1156502409_1156502416

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1156502409 1156502416
Species Human (GRCh38) Human (GRCh38)
Location 18:37567779-37567801 18:37567810-37567832
Sequence CCATTTGGTACAAGCACAATACG CAGCGCCGGAGGAGGCCCGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!