ID: 1156516842_1156516854

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1156516842 1156516854
Species Human (GRCh38) Human (GRCh38)
Location 18:37687421-37687443 18:37687468-37687490
Sequence CCCTACAGCTTCTGGAGAGCAGG CTGTGCCTTGTGCAGTACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!