ID: 1156517186_1156517197

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1156517186 1156517197
Species Human (GRCh38) Human (GRCh38)
Location 18:37690327-37690349 18:37690378-37690400
Sequence CCCTGAAGACCTCCCAGTAGGAC TGATGATTCTGACCCTGTGTAGG
Strand - +
Off-target summary {0: 2, 1: 42, 2: 320, 3: 506, 4: 575} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!