ID: 1156578025_1156578027

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1156578025 1156578027
Species Human (GRCh38) Human (GRCh38)
Location 18:38342038-38342060 18:38342052-38342074
Sequence CCAAGATGGGAGATGGGTTAATG GGGTTAATGGTAGCATGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114} {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!