ID: 1156588680_1156588683

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1156588680 1156588683
Species Human (GRCh38) Human (GRCh38)
Location 18:38461373-38461395 18:38461405-38461427
Sequence CCAATCAATAAGAGGCCAATGTT CAATCAGAACACTAGGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 120} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!