ID: 1156602613_1156602616

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1156602613 1156602616
Species Human (GRCh38) Human (GRCh38)
Location 18:38627308-38627330 18:38627322-38627344
Sequence CCTGACCTTTTCTGCAGATATCT CAGATATCTCTTATTGATTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!