ID: 1156630526_1156630530

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1156630526 1156630530
Species Human (GRCh38) Human (GRCh38)
Location 18:38962933-38962955 18:38962959-38962981
Sequence CCTTTCCCGTGTCTGGGTTGTAC CCAATTTCATGTCATCCACTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!