ID: 1156640180_1156640183

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1156640180 1156640183
Species Human (GRCh38) Human (GRCh38)
Location 18:39085649-39085671 18:39085670-39085692
Sequence CCGAAAGTGCCGGGATTACAGGC GCGTGAGCCACCGCCTTTGGTGG
Strand - +
Off-target summary {0: 1911, 1: 221243, 2: 273304, 3: 186347, 4: 142382} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!