ID: 1156865265_1156865268

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1156865265 1156865268
Species Human (GRCh38) Human (GRCh38)
Location 18:41882035-41882057 18:41882066-41882088
Sequence CCAAGGCCATTTATATTGTTTTG TCTCCCTTTCCAGTAACTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!