ID: 1156905147_1156905150

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1156905147 1156905150
Species Human (GRCh38) Human (GRCh38)
Location 18:42343659-42343681 18:42343688-42343710
Sequence CCTTCGCCTTCCAGACTGCGTCT ACCATTCAATCAAAATTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 16, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!